Top » Catalog » SNPs » FGC15270

$18.00

FGC15270
[FGC15270]

FGC15270
hg38 Position: ChrY:14076196..14076196
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC15270_F AGTAAGATGGGTTTGGCTTGG
Reverse Primer: FGC15270_R GAGGCATCTAGGTGTAGTTGCAG
Reviews

Customers who bought this product also purchased
A732
A732
DYS533
DYS533
YSEQ-Gamma
YSEQ-Gamma
A10245
A10245
A10244
A10244
A5395
A5395
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies