Top » Catalog » SNPs » FGC15271

$15.00

FGC15271
[FGC15271]

FGC15271
hg38 Position: ChrY:15420591..15420591
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC15271_F GTGCTGCAATTACAGGAATGAG
Reverse Primer: FGC15271_R TACGCACCTGAGGAGCTCTC
Reviews

Customers who bought this product also purchased
A732
A732
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
DNA Sample Kit
DNA Sample Kit
A684
A684
A508
A508
FGC15273
FGC15273
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies