Top » Catalog » SNPs » FGC15274

$18.00

FGC15274
[FGC15274]

FGC15274
hg38 Position: ChrY:8044908..8044908
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC15274_F CAGAACACACATGACATTGCAC
Reverse Primer: FGC15274_R GATAGTCACATTCTCTTGGTACAGG
Reviews

Customers who bought this product also purchased
Y-GATA-H4
Y-GATA-H4
A10245
A10245
A10244
A10244
A10243
A10243
FGC45251
FGC45251
PF1237
PF1237
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies