Top » Catalog » SNPs » A9001

$17.50

A9001
[A9001]

A9001
HG19 Position: ChrY:14771054..14771054
Ancestral: T
Derived: C
Reference: Robert Hughes (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS3386
Forward Primer: A9001_F TGCTTCTGACATACAAACAAACC
Reverse Primer: A9001_R TTTGCCATGCATCGAGATAG
Reviews (1)

Customers who bought this product also purchased
Z255
Z255
Z17970
Z17970
Z39589
Z39589
FGC11134
FGC11134
Z17300
Z17300
DF13
DF13
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x HVR2
1 x mtComplete
1 x HVR1
$229.00
Haplogroup Info
Other products
Currencies