Top » Catalog » SNPs » A9001

$18.00

A9001
[A9001]

A9001
HG19 Position: ChrY:12659123..12659123
Ancestral: T
Derived: C
Reference: Robert Hughes (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS3386
Forward Primer: A9001_F TGCTTCTGACATACAAACAAACC
Reverse Primer: A9001_R TTTGCCATGCATCGAGATAG
Reviews (1)

Customers who bought this product also purchased
Z17300
Z17300
A7297
A7297
DF13
DF13
L513
L513
MC14
MC14
BY9000
BY9000
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies