Top » Catalog » SNPs » A9001

$18.00

A9001
[A9001]

A9001
HG19 Position: ChrY:12659123..12659123
Ancestral: T
Derived: C
Reference: Robert Hughes (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS3386
Forward Primer: A9001_F TGCTTCTGACATACAAACAAACC
Reverse Primer: A9001_R TTTGCCATGCATCGAGATAG
Reviews (1)

Customers who bought this product also purchased
CTS3386
CTS3386
S19268
S19268
Z253
Z253
FGC5494
FGC5494
FGC13302
FGC13302
DF49
DF49
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies