Top » Catalog » SNPs » A9001

$18.00

A9001
[A9001]

A9001
HG19 Position: ChrY:14771054..14771054
Ancestral: T
Derived: C
Reference: Robert Hughes (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS3386
Forward Primer: A9001_F TGCTTCTGACATACAAACAAACC
Reverse Primer: A9001_R TTTGCCATGCATCGAGATAG
Reviews (1)

Customers who bought this product also purchased
R1b-L21 Super-Clade Orientation Panel
R1b-L21 Super-Clade Orientation Panel
BY9000
BY9000
DF21
DF21
CTS3386
CTS3386
S19268
S19268
Z253
Z253
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies