Top » Catalog » SNPs » FGC15283

$18.00

FGC15283
[FGC15283]

FGC15283
hg38 Position: ChrY:16071121..16071121
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC15283_F TCCCTCCTTCTCCCTAATCC
Reverse Primer: FGC15283_R TATTCCCTTAATTTGCCCAATC
Reviews

Customers who bought this product also purchased
CDY
CDY
DYS389I+II
DYS389I+II
PF1237
PF1237
A1771
A1771
A1770
A1770
FGC15273
FGC15273
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies