Top » Catalog » SNPs » FGC15284

$18.00

FGC15284
[FGC15284]

FGC15284
HG19 Position: ChrY:20393187..20393187
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC15284_F CATTGCTGAGAGGAGTTGAGG
Reverse Primer: FGC15284_R GAAATCCTTGTGTGCTGGTG
Reviews

Customers who bought this product also purchased
A13703
A13703
DYS390
DYS390
DYS607
DYS607
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
CDY
CDY
DYS389I+II
DYS389I+II
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies