Top » Catalog » SNPs » A514

$19.00

A514
[A514]

A514
hg38 Position: ChrY:19943923..19943923
Ancestral: C
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A514_F ATGCAGTTTTCCTTGTATTAATTGTTC
Reverse Primer: A514_R CAGCCAACATCACTCTAAATGG
Reviews

Customers who bought this product also purchased
A604
A604
A603
A603
A513
A513
A512
A512
A511
A511
A510
A510
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies