Top » Catalog » SNPs » Z6057

$18.00

Z6057
[Z6057]

Z6057
hg38 Position: ChrY:12287017..12287017
Ancestral: A
Derived: G
Reference: Y DNA community
ISOGG Haplogroup: J2a (not listed)
Comments: downstream of J2a L26. upstream of M68
Forward Primer: Z6057_F GAAAGAGTGGGGAAAAGAGC
Reverse Primer: Z6057_R GAAACATCCCGTCCTCGAG
Reviews

Customers who bought this product also purchased
Y14434
Y14434
SK1363
SK1363
L26
L26
Y23382
Y23382
J2a1-Y14434 Wiltshire, England Segregation Panel
J2a1-Y14434 Wiltshire, England Segregation Panel
Y22057
Y22057
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies