Top » Catalog » SNPs » Z6057

$18.00

Z6057
[Z6057]

Z6057
hg38 Position: ChrY:12287017..12287017
Ancestral: A
Derived: G
Reference: Y DNA community
ISOGG Haplogroup: J2a (not listed)
Comments: downstream of J2a L26. upstream of M68
Forward Primer: Z6057_F GAAAGAGTGGGGAAAAGAGC
Reverse Primer: Z6057_R GAAACATCCCGTCCTCGAG
Reviews

Customers who bought this product also purchased
J2a1-Y14434 Wiltshire, England Segregation Panel
J2a1-Y14434 Wiltshire, England Segregation Panel
Y22057
Y22057
Y22056
Y22056
Y14434
Y14434
SK1363
SK1363
L26
L26
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies