Top » Catalog » SNPs » ZS6038

$18.00

ZS6038
[ZS6038]

ZS6038
hg38 Position: ChrY:7358740..7358740
Ancestral: T
Derived: C
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream BY9. Found in Big Y sample M5060
Forward Primer: ZS6038_F CTGCAGCTTTTAACATTTGACTG
Reverse Primer: ZS6038_R GCAGGAGGCTAAAGTGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies