Top » Catalog » SNPs » FGC78668

$18.00

FGC78668
[FGC78668]

FGC78668
hg38 Position: ChrY:11006819..11006819
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC78668_F ACAGGATATCACTGTGTCACCG
Reverse Primer: FGC78668_R ATGGAAGGTGATGCATTGAAG
Reviews

Customers who bought this product also purchased
FGC1707
FGC1707
BY8
BY8
FGC19901
FGC19901
M5649
M5649
BY4
BY4
ZS2010
ZS2010
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies