Top » Catalog » SNPs » FGC78668

$18.00

FGC78668
[FGC78668]

FGC78668
hg38 Position: ChrY:11006819..11006819
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC78668_F ACAGGATATCACTGTGTCACCG
Reverse Primer: FGC78668_R ATGGAAGGTGATGCATTGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies