Top » Catalog » SNPs » FGC78668

$18.00

FGC78668
[FGC78668]

FGC78668
hg38 Position: ChrY:11006819..11006819
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC78668_F ACAGGATATCACTGTGTCACCG
Reverse Primer: FGC78668_R ATGGAAGGTGATGCATTGAAG
Reviews

Customers who bought this product also purchased
FGC1695
FGC1695
BY9
BY9
FGC4415
FGC4415
FGC19909
FGC19909
ZS10047
ZS10047
FGC1707
FGC1707
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies