Top » Catalog » SNPs » FGC67346

$18.00

FGC67346
[FGC67346]

FGC67346
hg38 Position: ChrY:15662233..15662233
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC67346_F GCAATGGTGCAATCTCCAG
Reverse Primer: FGC67346_R AATAAAAAAGGTTTAGAGTCAAATGACTTATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies