Top » Catalog » SNPs » FGC67346

$18.00

FGC67346
[FGC67346]

FGC67346
hg38 Position: ChrY:15662233..15662233
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC67346_F GCAATGGTGCAATCTCCAG
Reverse Primer: FGC67346_R AATAAAAAAGGTTTAGAGTCAAATGACTTATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC67346
1 x Y267300
1 x A25411
1 x BY110745
1 x Y249573
1 x BY110744
1 x Y242509
1 x FGC78668
1 x FGC82488
1 x ZS6038
$180.00
Haplogroup Info
Other products
Currencies