Top » Catalog » SNPs » BY32579

$18.00

BY32579
[BY32579]

BY32579
hg38 Position: ChrY:7927390..7927390
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY32579_F GACACCTTTAACTGTCAGCTTTGC
Reverse Primer: BY32579_R CCACATCACCTACATGATGTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY83264
1 x BY110744
1 x BY131225
1 x Y85066
1 x BY32583
1 x FGC58487
1 x BY32579
1 x FT36831
$144.00
Haplogroup Info
Other products
Currencies