Top » Catalog » SNPs » BY32583

$18.00

BY32583
[BY32583]

BY32583
hg38 Position: ChrY:14371602..14371602
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY32583_F GGATTATCAATGTTCATACAGATCTCAC
Reverse Primer: BY32583_R TCTAGAGTAAATTAAAAACATTTTGTAGCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies