Top » Catalog » SNPs » FT137363

$18.00

FT137363
[FT137363]

FT137363
hg38 Position: ChrY:7655419..7655419
Ancestral: G
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT137363_F CTTTTCTTTGGAAGTTTCATACTTAAGTG
Reverse Primer: FT137363_R CTTTTGAATTTTAAAAATAATATGTAAAAACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies