Top » Catalog » SNPs » FT137761

$18.00

FT137761
[FT137761]

FT137761
hg38 Position: ChrY:8794407..8794407
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT137761_F CAGATTAATTCAAGAACAGAAAACAAG
Reverse Primer: FT137761_R TTTTCAATATTCTGTAATTTCTGACATATACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies