Top » Catalog » SNPs » FT140529

$18.00

FT140529
[FT140529]

FT140529
hg38 Position: ChrY:19457007..19457007
Ancestral: C
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT140529_F CATTCCAGAGAGGAGCCAAG
Reverse Primer: FT140529_R TTGGGTTGGGGTACAGACTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies