Top » Catalog » SNPs » BY83264

$18.00

BY83264
[BY83264]

BY83264
hg38 Position: ChrY:10198514..10198514
Ancestral: G
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY83264_F CATTCTTTTTTGTTGGTTTTCAGG
Reverse Primer: BY83264_R ACACGCTGAGCCAGTCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies