Top » Catalog » SNPs » FGC64473

$18.00

FGC64473
[FGC64473]

FGC64473
hg38 Position: ChrY:6561781..6561781
Ancestral: A
Derived: T
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC64473_F ACACAAAGACCAATGGAGCAG
Reverse Primer: FGC64473_R TTTTTCCCATGAAGGTCGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY83264
$18.00
Haplogroup Info
Other products
Currencies