Top » Catalog » SNPs » FGC58487

$18.00

FGC58487
[FGC58487]

FGC58487
hg38 Position: ChrY:20647868..20647868
Ancestral: T
Derived: G
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC58487_F GGACAACAGTAGACTAGGAGCTGTG
Reverse Primer: FGC58487_R TGCCCAATAACCAAATCCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY83264
$18.00
Haplogroup Info
Other products
Currencies