Top » Catalog » SNPs » Y85066

$18.00

Y85066
[Y85066]

Y85066
hg38 Position: ChrY:7950248..7950248
Ancestral: A
Derived: C
Reference: YFull (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: Y85066_F AGTTAGTAAACTTCTGTGACCTTTATAGCA
Reverse Primer: Y85066_R ATATTGTGGCATATACCTGAGAACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies