Top » Catalog » SNPs » BY131225

$18.00

BY131225
[BY131225]

BY131225
hg38 Position: ChrY:19061692..19061692
Ancestral: G
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY131225_F AGACACTCCCATATATTGACAATGG
Reverse Primer: BY131225_R TGTGCCTGTCACATAATGGATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies