Top » Catalog » SNPs » Y76722

$18.00

Y76722
[Y76722]

Y76722
hg38 Position: ChrY:19386182..19386182
Ancestral: C
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: Y76722_F AGTTCTGAAGAGGCATTGCG
Reverse Primer: Y76722_R GCCATAGACCAACAGACTCAGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies