Top » Catalog » SNPs » A29507

$18.00

A29507
[A29507]

A29507
hg38 Position: ChrY:12208714..12208714
Ancestral: G
Derived: A
Reference: Danilo Lukic (2021)
ISOGG Haplogroup: I2
Comments: Aka YFS11943490
Forward Primer: A29507_F CTTAAGTTTATTTTTCATGTTCCACAAGTC
Reverse Primer: A29507_R TAGAAGGGTATAAAATAAAAGCTGAATAATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies