Top » Catalog » SNPs » FT83824

$18.00

FT83824
[FT83824]

FT83824
hg38 Position: ChrY:15018470..15018470
Ancestral: G
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FT83824_F CTATGGAGACAGTAGATTAAAACAATACG
Reverse Primer: FT83824_R GGAGAGATTCTCAAATTTAGTCAGTAAATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FT105278
1 x A29507
1 x A28342
1 x BY14436
$72.00
Haplogroup Info
Other products
Currencies