Top » Catalog » SNPs » BY186550

$18.00

BY186550
[BY186550]

BY186550
hg38 Position: ChrY:8125493..8125493
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY186550_F AGAAATTCTGAGCGGGACATC
Reverse Primer: BY186550_R GGAACCATGAATGTAAAAGATTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK521
1 x BY177896
$36.00
Haplogroup Info
Other products
Currencies