Top » Catalog » SNPs » A29511

$18.00

A29511
[A29511]

A29511
hg38 Position: ChrY:14287747..14287747
Ancestral: A
Derived: T
Reference: YSEQ (2021)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A29511_F GCAAAGGATATGAAGATAAACTTCTTG
Reverse Primer: A29511_R GTTTGGTTTTCTGTCCTTGTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies