Top » Catalog » SNPs » Y238333

$18.00

Y238333
[Y238333]

Y238333
hg38 Position: ChrY:19864825..19864825
Ancestral: A
Derived: G
Reference: YFull (2021)
ISOGG Haplogroup: I2
Comments: Below L621 > CTS10228 > PH908 > Y84307
Forward Primer: Y238333_F TGCAGAAATAACTGGGTCCTC
Reverse Primer: Y238333_R CTTGTTCCCCCATTACATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies