Top » Catalog » SNPs » Y238341

$18.00

Y238341
[Y238341]

Y238341
hg38 Position: ChrY:14843294..14843294
Ancestral: T
Derived: G
Reference: YFull (2021)
ISOGG Haplogroup: I2
Comments: Below L621 > CTS10228 > PH908 > Y84307
Forward Primer: Y238341_F GTTATTCTAGAAATCCAATGTTAAATGC
Reverse Primer: Y238341_R ATGTCACAAGACTGTCATGTTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x HVR1
1 x mtComplete
$170.00
Haplogroup Info
Other products
Currencies