Top » Catalog » SNPs » FT42822

$18.00

FT42822
[FT42822]

FT42822
hg38 Position: ChrY:15710090..15710090
Ancestral: C
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FT42822_F CTGGTAGGTGCATGTAATCCC
Reverse Primer: FT42822_R CTCCCTAACTCCATGTATTATTATTATGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies