Top » Catalog » SNPs » Y22085

$18.00

Y22085
[Y22085]

Y22085
hg38 Position: ChrY:19014391..19014391
Ancestral: T
Derived: C
Reference: YFull (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: Y22085_F TCAGAATCTATTCTAATAACGGAAGAGC
Reverse Primer: Y22085_R GCACTCACAGGCACAAATAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies