Top » Catalog » SNPs » FGC58302

$18.00

FGC58302
[FGC58302]

FGC58302
hg38 Position: ChrY:14465686..14465686
Ancestral: T
Derived: G
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC58302_F GTGAAAATGGATCAATTAATTCAATTG
Reverse Primer: FGC58302_R CGATTTGTGATTCCAATATATTTAAAAGTAC
Reviews

Customers who bought this product also purchased
Y133592
Y133592
BY9
BY9
FGC58306
FGC58306
BY8
BY8
Y14418
Y14418
J1-BY8 Panel
J1-BY8 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies