Top » Catalog » SNPs » FGC58306

$18.00

FGC58306
[FGC58306]

FGC58306
hg38 Position: ChrY:16713795..16713795
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC58306_F CAACATGGTGAAACATCGG
Reverse Primer: FGC58306_R AATTAGAGAAATACTCTGGAATTAAAGAAATACTC
Reviews

Customers who bought this product also purchased
Y14282
Y14282
FGC58302
FGC58302
FGC19909
FGC19909
BY103640
BY103640
BY9
BY9
Y133592
Y133592
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies