Top » Catalog » SNPs » FGC58306

$18.00

FGC58306
[FGC58306]

FGC58306
hg38 Position: ChrY:16713795..16713795
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC58306_F CAACATGGTGAAACATCGG
Reverse Primer: FGC58306_R AATTAGAGAAATACTCTGGAATTAAAGAAATACTC
Reviews

Customers who bought this product also purchased
J1-BY8 Panel
J1-BY8 Panel
FGC58290
FGC58290
Y14282
Y14282
FGC19909
FGC19909
BY103640
BY103640
BY9
BY9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies