Top » Catalog » SNPs » FGC58489

$18.00

FGC58489
[FGC58489]

FGC58489
hg38 Position: ChrY:14457380..14457382
Ancestral: ins
Derived: del
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC58489_F CCTTCTTGTAGAAGTGTTCTCTTAAGG
Reverse Primer: FGC58489_R CAACCCATATCAGACACTTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies