Top » Catalog » SNPs » A29288

$18.00

A29288
[A29288]

A29288
hg38 Position: ChrY:7092688..7092688
Ancestral: A
Derived: T
Reference: YSEQ (2021)
ISOGG Haplogroup: R1a
Comments: Below Z280 > YP237 > YP951
Forward Primer: A29288_F AGTTTGTATACCAATAAGATGTGCGAG
Reverse Primer: A29288_R GGGTAACCCTTGTCCACCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies