Top » Catalog » SNPs » A29289

$18.00

A29289
[A29289]

A29289
hg38 Position: ChrY:7186488..7186488
Ancestral: G
Derived: T
Reference: YSEQ (2021)
ISOGG Haplogroup: R1a
Comments: Below Z280 > YP237 > YP951
Forward Primer: A29289_F GGTCGTCCTCACCACTCG
Reverse Primer: A29289_R TTATCCACACCCTAAGAGACGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies