Top » Catalog » SNPs » A29293

$18.00

A29293
[A29293]

A29293
hg38 Position: ChrY:14168812..14168812
Ancestral: A
Derived: G
Reference: YSEQ (2021)
ISOGG Haplogroup: R1a
Comments: Below Z280 > YP237 > YP951
Forward Primer: A29293_F CTTCCTGGCCATCAGCTAGT
Reverse Primer: A29293_R AAGCAGACAAAATTGGAGTCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A29299
1 x A29295
1 x A29298
1 x A29293
1 x A29292
$90.00
Haplogroup Info
Other products
Currencies