Top » Catalog » SNPs » A29295

$18.00

A29295
[A29295]

A29295
hg38 Position: ChrY:15645930..15645930
Ancestral: G
Derived: T
Reference: YSEQ (2021)
ISOGG Haplogroup: R1a
Comments: Below Z280 > YP237 > YP951
Forward Primer: A29295_F GTCTTCTTTTGAGAAGTGCCTGTG
Reverse Primer: A29295_R ACAAATGAATAAAATCAAGTCAATTGATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A29289
1 x A29288
$36.00
Haplogroup Info
Other products
Currencies