Top » Catalog » SNPs » A29296

$18.00

A29296
[A29296]

A29296
hg38 Position: ChrY:15982579..15982579
Ancestral: T
Derived: A
Reference: YSEQ (2021)
ISOGG Haplogroup: R1a
Comments: Below Z280 > YP237 > YP951
Forward Primer: A29296_F ACAGGATGTGAAGCTAGACAACTG
Reverse Primer: A29296_R CTAGCCATTATGTTAGCCAGTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies