Top » Catalog » SNPs » A29297

$18.00

A29297
[A29297]

A29297
hg38 Position: ChrY:16591112..16591112
Ancestral: A
Derived: G
Reference: YSEQ (2021)
ISOGG Haplogroup: R1a
Comments: Below Z280 > YP237 > YP951
Forward Primer: A29297_F CAAAAGAAGCTATAATGAGAGTGAACTC
Reverse Primer: A29297_R CCTTCTCCTAGGCCCCTACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies