Top » Catalog » SNPs » A29300

$18.00

A29300
[A29300]

A29300
hg38 Position: ChrY:19351876..19351876
Ancestral: C
Derived: A
Reference: YSEQ (2021)
ISOGG Haplogroup: R1a
Comments: Below Z280 > YP237 > YP951
Forward Primer: A29300_F TTTTAACTTCTAATTCTTTAACTTTTACATTGAG
Reverse Primer: A29300_R CGGGTGTTAAGGCCCTTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies