Top » Catalog » SNPs » A29303

$18.00

A29303
[A29303]

A29303
hg38 Position: ChrY:21080000..21080000
Ancestral: T
Derived: C
Reference: YSEQ (2021)
ISOGG Haplogroup: R1a
Comments: Below Z280 > YP237 > YP951
Forward Primer: A29303_F ACATAGGCCCAGCTCACAAG
Reverse Primer: A29303_R GCAGATCACAAGGTCAGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies