Top » Catalog » SNPs » Y188616

$18.00

Y188616
[Y188616]

Y188616
hg38 Position: ChrY:11037453..11037453
Ancestral: T
Derived: C
Reference: YFull (2018)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: Y188616_F ACTCCACTCAAATCCACTCCTC
Reverse Primer: Y188616_R GAATGGAATGAAGTTGAATGTAGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies