Top » Catalog » SNPs » A516

$18.00

A516
[A516]

A516
hg38 Position: ChrY:13814762..13814762
Ancestral: T
Derived: G
Reference: Naeim Al-Suwaidi (2014)
ISOGG Haplogroup: J2a1h2 (not listed)
Comments: Found in a L25+ F3133+ Z7704+ L363+ person
Forward Primer: A516_F CTATGCTCTCAGAAGTGTACCTCTTG
Reverse Primer: A516_R GAGAACCATACCCGGAATACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies