Top » Catalog » SNPs » PF5401

$18.00

PF5401
[PF5401]

PF5401
hg38 Position: ChrY:21834808..21834808
Ancestral: C
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a1a1a1a2a (not listed)
Comments: Below L25 / S399
Forward Primer: PF5401_F AACGGACTTCGGGTATGTCA
Reverse Primer: PF5401_R GGTGTGTTTCTGAAGGTACTTTC
Reviews

Customers who bought this product also purchased
Z39993
Z39993
FT376961
FT376961
FGC35474
FGC35474
Y164808
Y164808
Y197867
Y197867
FT133518
FT133518
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies