Top » Catalog » SNPs » PF5401

$18.00

PF5401
[PF5401]

PF5401
hg38 Position: ChrY:21834808..21834808
Ancestral: C
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a1a1a1a2a (not listed)
Comments: Below L25 / S399
Forward Primer: PF5401_F AACGGACTTCGGGTATGTCA
Reverse Primer: PF5401_R GGTGTGTTTCTGAAGGTACTTTC
Reviews

Customers who bought this product also purchased
Z39491
Z39491
PF5197
PF5197
FGC34117
FGC34117
Z2222
Z2222
F3369
F3369
Z6064
Z6064
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies